Proofreading Website: What Can You Find In One?

/in /by

 Proofreading website: Are there any measures to ensure that you submit special reports for any online document that you’ll handle? Below, we will look at some to ensure that you can manage your documents without any difficulties. Read on to know more about that!

How to Proofread Your Documents

When writing any paper, you must be ready to countercheck the final copies and present recommendable reports. Often, individuals fail to proofread their documents because they didn’t have enough time to do so. Materials on  https://rankmywriter.com/samedayessay-com-review  helps a lot to be able to countercheck the final copies and present recommendable reports.

There are measures you can take to ensure that you can manage your papers without difficulties. They include:

1. Proper planning

Proper planning is the beginning of success. Nothing guarantees success. Be quick to set enough time when managing your academic or professional documents. Many times, individuals fail to have a planner, and they end up presenting unworthy reports.

It might be of help when you develop a planner. Doing so will allow you to write your papers and proofread them without any difficulties.

When you have a clear outline for your paper, you can start to write your copy without any difficulties. Besides, you’ll be able to learn the proper format for writing your copy. If you develop a proper style, you can proofread the final report with ease.

2. Research

Researching is an easy way of finding relevant information to include in your proofreading website. Luckily enough, you can secure enough information to include in the website. Besides, you’ll come across sample copies that can guide you through the entire writing process.

It helps a lot to be in a position to handle every section in your documents correctly. If you can proofread the entire document by yourself, there are higher chances that you won’tface any mistakes when writing. That would be horrible!

Through research, you can detect if the theme in your paperwork is relevant to your particular subject. From there, you can develop an exciting story in your writing. Remember, you must prove that your work is relevant. As such, you’ll need relevant data to include in the reports. When you research, you can secure sources with valid data to support the theme in your paperwork.

Useful resources:

Why the Need for Earplugs When You Are Staying Together In A Dorm or Apartment 

Why Should a Professor Crush A Student’s Dream and Develop Hatred? 

6 Tips to Deliver an Excellent Book Report

Revised

/in /by

Power, Politics, and CultureOverviewIn your second assignment, you created a professional development plan using EI building blocks and motivation. In this last assignment, you will examine how politics and power influence an organization and its culture.In business, power and politics greatly influence an organizational culture and may hinder organizational productivity. In your role as consultant, you observed power and politics influence on the corporate culture.InstructionsWrite a 5–7 page report that addresses the following:

  1. Influence of Politics      and Power:
    • Explain how politics       and power-play may have influenced the organization’s culture.
  2. Sources of Power:
    • Explore at least one       source of power and describe how management could use this influence to       benefit the department and improve organizational performance.
  3. Leadership Behavior and      Culture:
    • Make recommendations       that support how the study of power and politics could influence       leadership behavior and improve the organization’s culture.
  4. Leadership Influence:
    • Discuss the importance       and complexity of leadership behavior in solving the issue you       identified. How does it influence organizational structure and       performance?
  5. References and      Citations:
    • Go to the Strayer University Online Library to locate at       least two resources.
    • In-text citations are       required when paraphrasing or quoting another source.
  6. Formatting and Writing      Standards:
    • This course requires       the use of Strayer Writing Standards. For assistance and information,       please refer to the Strayer Writing Standards link in the left-hand menu       of your course.

    Confidentiality: Since you will be addressing real issues in real organizations in your assignments, it is important to respect confidentiality. Feel free to use an alias for any company or individuals you might mention in your assignments. Remember that all discussions about these organization should only occur within this course and not be shared with people outside the course.The specific course learning outcome associated with this assignment is:

  • Analyze the influence of      politics, power, and leadership behavior on organizational culture.

Follow writing rubric that has been uploaded  

use this information to revise and do not copy and paste 

The organization I who issues I will discuss is G4S Security Company. The company is known

nationwide, but I work under the Altria account at Phillip Morris manufacturing plant. The issue I have observed is the lack of professionalism with management throughout the contract. Being unprofessional can be the way you dress, punctually, time off from work, organization skills, communication skills, and their attitude towards the employees. The company expects employees to be professional and respectful to the client, supervisors, and co-workers. But they do not demonstrate those same qualities. The supervisors of this company lack enough skills to provide the best security training services to the employees. Therefore, it has become a task for the organization’s management to evaluate the best candidate.

The primary cause of this issue is associated with inadequate supervisors who select unprofessional security personnel. To obtain the best individuals for the position is to monitor how they perform during training. That is difficult because management lacks the professional skills to recognize and hire qualified employees. Supervisors do not consider the applicants based on their skills in action and not based on a test that makes it hard to find the most qualified applicants.

If professionalism is not exhibited, it can hinder the morale of their employees. Also, it can destroy the lines of communication. Unprofessionalism can cause workers to leave the company,

and employees will start missing work often, and that would require others to do mandatory overtime because of a shortage of workers. The employees lose respect for management because of their lack of loyalty to senior officers and lack of empathy to an officer having personal issues and need time off. If employees are dissatisfied, the company can lose the contract.

Please discuss the benefit of integrating technology into instruction, and the possible problems you need to consider to make learning more effective in the technology assisted learning environment.

/in /by
  1. It must be written in APA style, without grammar and spelling errors. You can find the APA citation samples and references in the teacher’s web site by clicking Comps Guide button. You are welcome to use the Microsoft Word APA style tool to insert APA style citations/References by clicking on References — Insert Citation — Add New Source, then fill out the APA form in Word according to the source provided.
  2. Your writing must address the question to the point, and demonstrate a clear understanding of the question. The answer that roams away from the topic/question is not acceptable.
  3. The paper needs to be four pages long for comps and six pages long for term paper, double space, in Times New Roman font type, and font size 12. You need to cite at least four academic publication reference citations.
  4. The writer needs to be able to go into an in-depth understanding of the issues you are discussing, and describe knowledgeably, experientially, theoretically, scholastically, analytically and critically. The superficial or shallow answer is not appropriate. The answer with a bunch of facts that lacks theory-based critical analysis is not appropriate, either.
  5. The writer needs to present evidence(s) to support his/her argument(s). It needs to develop logically, clearly and coherently with clarity.
  6. It needs a starting (introductory) paragraph and an ending (conclusion) paragraph.
  7. It needs correct in-text citation and at least four references at the end of the paper (The reference page does not count for the paper length).
  8. The paper could get higher grade points that is written wisely, critically, reflectively, creatively and imaginatively. It should be related to the personal experiences or the current school practice in accordance with the academic knowledge and theories.

Reply 1 and 2 ,150 words each one by 07/03/2021 at 6:00 pm ,please add references and citations

/in /by

Reply 1

 
Re: Topic 7 DQ 2

TOPIC 7 DQ 2

In order to evaluate an evidence-based practice project, it is important to be able to determine the effectiveness of your change. Discuss one way you will be able to evaluate whether your project made a difference in practice.

My evidence-based project was based on safety concerns for patients admitted to behavioral health organizations diagnosed with post-traumatic stress disorder and eating disorders. One of the core nursing measures in psychiatric hospitals is ensuring patient safety, especially when patients are suicidal and have persistent self-harm urges. According to Ginex (2018), they provide that the change we expected to happen is one of the most critical but sometimes complex phases in the evidence-based practice (EBP) approach. Following implementing a practice change, it’s crucial to determine whether the desired outcome was accomplished.

Evidence-based solutions in healthcare seek to improve the quality of care provided to patients while also increasing treatment results. Furthermore, lowering healthcare costs is becoming a key issue in implementing evidence-based practice in the healthcare context. Evaluation is critica to determine if the organization has effectively implemented the planned changes in its operations, evaluation is critical. As a result, it’s vital to use an assessment approach to assess the expected improvements in the healthcare context.

In our unit, we give community sheets every shift where patients write their safety levels and safety concerns during each shift and their plans for the day. From those filled sheets, I can evaluate how much safer they feel after introducing the proposed change of checking on patients every 15minutes, not only visualizing physically but also talking to them about how they are doing. Another method is by working with the quality department to analyze our self-harm and suicide attempt incidents before introduction and after introducing the change proposal.

Reference

Ginex. P (2018), Use These Methods to Evaluate EBP Outcomes and Disseminate Results. Retrieved from https://voice.ons.org/news-and-views/use-these-methods-to-evaluate-ebp-outcomes-and-disseminate-results

Reply 2

 
2 postsRe: Topic 7 DQ 2

Central line-associated bloodstream infections (CLABSIs) result in thousands of deaths each year and billions of dollars in added costs to the U.S. healthcare system (CDC, 2011). For the prevention of these infections, CDC has implemented many evidence-based guidelines and practices. Many of the studies and researches revealed that these practices reduced the rate of CLABSI considerably. 

Should organize staff education to allow the healthcare workers to collaborate, learn from, and support each other. The ‘learning by teaching method’-based education to implement CLABSI prevention was found the most effective way(Sang-Won et al., 2017). The proposed change practice is to educate the staff about the CLABSI bundles for six months with pre and post-questionnaires to check the knowledge level and coaching as needed. Then, for the next six months, the education and coaching effectiveness could check through direct observation and chart audits. When comparing the CLABSI rate before and after the education intervention will reveal the significance of the education.

 Reference

Centers for Disease Control and Prevention. (2011, February 7). Central Line-associated Bloodstream Infections: Resources for Patients and Healthcare Providers. Centers for Disease Control and Prevention. https://www.cdc.gov/hai/bsi/clabsi-resources.html.

Sang-Won, P., Chung, W.-Y., Ji-Hawan, B., An, H.-S., & Suhui, K. (2017). Implementation of central line-associated bloodstream infection prevention bundles in a surgical intensive care unit using peer tutoring. Antimicrobial resistance and infection control. https://pubmed.ncbi.nlm.nih.gov/29026536/.

Evolution and Ecology. Answer the following 5 questions. Due in 20 hours

/in /by

1. Many endemic species are found in areas that are geographically isolated. Suggest two plausible scientific explanations for why this is so. Back up your explanations with details and information from the course to (the reader) that these are plausible explanations.

2. There are three small islands with lizards on them. 

Island 1 has a species richness of 30, Simpson’s Diversity Index of 0.31, and a Shannon Weiner Index of 1.1

Island 2 has a species richness of 30, Simpson’s Diversity Index of 0.37, and a Shannon Weiner Index of 1.0

Island 3 has a species richness of 30, Simpson’s Diversity Index of 0.54, and a Shannon Weiner Index of 0.6

Based on these metrics, which island will you petition the government to preserve? Defend your answer using the concepts of species richness and species diversity, as well as what you have learned about conservation biology.

3. Evolution does NOT always lead to organisms having the traits that are best suited to their environment. Why not?

4. In nature, sometimes we observe patterns that can be created by two or more different processes. Give one example and explain the processes that could lead to that pattern.

5. What best explains the current global distribution of marsupials? 

quick trip analysis

/in /by

 

QuikTrip Case Study

Overview

Complete an analysis of QuikTrip. Assess the organizational layout, performance metrics, and the technology that is used to measure performance and connect with consumers.

Instructions

Using the QuikTrip case study, write a 4–6 page paper in which you:

Evaluate QuikTrip’s operations strategy and explain how the organization seeks to gain a competitive advantage in terms of sustainability.

Analyze how operation management activities affect the customer experience. Select two operation management challenges and provide the solutions for confronting them.

Examine QuikTrip’s value chain and evaluate its effectiveness to operations in terms of quality, value creation, and customer satisfaction.

Determine the different types of performance measurements that can be used to measure QuikTrip’s service-delivery system design. Select at least two types that can be applied and provide justifications for the selection.

Examine the different types of technologies applied to QuikTrip’s service operations and evaluate how the technologies strengthen the value chain.

Use at least two quality resources in this assignment that do not include the initial case study. Note: Wikipedia and similar websites do not qualify as quality resources.

This course requires the use of Strayer Writing Standards. For assistance and information, please refer to the Strayer Writing Standards link in the left-hand menu of your course. Check with your professor for any additional instructions.

The specific course learning outcomes associated with this assignment are:

Protein Structure

/in /by

  

CHM-530: Protein Structure Prediction

Introduction

In a postgenomic world, the heavy lifting has turned to protein-structure prediction from sequence (DNA or translated amino acid). There is a plethora of tools available to the biochemist to do just that. While these are still just predictive tools, they are an invaluable asset for understanding molecular interactions within the cell. In this assignment, you will translate a given DNA sequence and then put it through a secondary structure prediction tool. Additionally, you will be asked to explain basic aspects of translation and the types of secondary structure that the prediction tool searches for in the amino acid sequence. Use the Lehninger Principles of Biochemistry textbook or other online sources to answer the questions. 

Procedure

1. Starting with the DNA sequence listed below, go to the ExPASy Tool (https://web.expasy.org/translate/). 

a. Cut and paste the sequence into the translate tool. The output shows different open reading frames. 

b. There will be six frames giving all possible protein sequences for the offered DNA sequence. Select the longest continuous, red-highlighted sequence (open reading frame), and click on the red “M” to gain access to the amino acid sequence. Be sure it says that there are 503 amino acids. 

c. Copy the single letter amino acid code, which should start with M, in FASTA format, and paste it into the “Protein Structure Report” below. Make sure only open reading frame amino acid information is copied and pasted into this worksheet. Answer the question associated with Part 1.

2. Take that single letter amino acid code and do a secondary structure prediction on the sequence using the SCRATCH Protein Predictor website. (http://scratch.proteomics.ics.uci.edu/). 

a. Paste in your converted amino acid sequence, and select the prediction option SSpro8: Secondary Structure (8 Class). You will be asked about the output of that selection. You can also choose whatever predictor options you want for your own curiousity. You will receive an e-mail with your results, which may take up to 30 minutes. 

The DNA sequence is on the next page

  

TGCTGACCCTATGATGTATCCTATGGTCATTTATTAAGATGTTATCCTAA
AAAGTATATAACGATTTATTATAGTGTGATAGTAATACCAGAACGAGAAA
TTAGAAAATTGTAAAAAAAGAATTTTAAAATATTATGCGGCTACTTTTCC
TACAGTTTCTGCAATTTTTGCTTCTTCTTCAGCAAATGCGCATAGCATTG
CTTCTATGTCGGCATATCCTTCTGCTTTTGCTGTCATTGCTATTTTGTTG
TATGTGGATATGTGCTCCTCTCCCTCTTTAGTAGCGAAATCAGATAGTAA
CTTCTTTACCTTTAATTCGGTGGCTACTTTTCCTACAGTTTCTGCAATTT
TTGCTTCTTCTTCAGCAAATGCGCATAGCATTGCTTCTATGTCGGCATAT
CCTTCTGCTTTTGCTGTCATTGCTATTTTGTTGTATGTGGATATGTGCTC
CTCTCCCTCTTTTATTGAGAATTCTTCTAATATTTTTTCTACTTTACTGG
ATATCATAGGTATTCGTAATGAATAATCGGAAGGCAAATATATAAGCATT
TGTTAAGCTTTTTTAATACTAAATATAATTAGCATTTTTGTATTTCAACA
AAGTTTGAGATTTTTGTATTACGGAACTAAAAATCCTCTAAAAAACTTAA
CTTGTATATAAAATTCTTTCGTATAATTTCTTTGCCTCTTCATACTTCTC
CTTTGATTTGGTTTCTAATTCGTTCTTCCTTTCAGGAAGTTTTTCAGCTA
ATAGTTTTGAGAGCATATAAACTGTAGCTGTAAGCATAAATTTCTCTTTT
AATTGCTCACTTTCCTTTTTATTTAACTCTTCGAACCAATTGGTTATATA
TTCTAACCCTAAATACTTTATCATTTTCTCTAATATTCCCCTAGCATGAC
CCAATTCAACTAAGGCTTTTTCCCTAATTTTTTCAGATTCTTCCTTTTTA
TTAACCTCCTCCAGCTTTTGAGAGGAGAACAATAGTAATAAATGGTCTTC
GGAGTTAGCCATAAAAAGCTCTTTTAATCCTATTTCAGTCTGTGTCCCCT
TCATCACCTTTAAATTGTATTCATAGCTAATATACTCTTGTTAAAATAAT
GATGACTAACTCCAATACTGACCAATGATGTCGTAACCCGAAACTGAATA
AAAGTAAAATCCTTCCCTACTGAGAATATTTGTATGATAACCTCAAAAAG
AATGAAAGCCCTTGAAATTAATAGCGAAGCATTAGGCGTGCCAACATTAC
TCTTGATGGAAAACGCAGGGAGAAGTGTAAAGGATGAAATAATGAAAAGA
CTGAATTTGGACTATTCTAAAAAGGTTGTAGTATTTGCAGGAACTGGTGG
AAAAGGAGGAGACGGATTAGTAGTAGCAAGGCACCTTGCCTCGGAAGGGT
CAGAGGTTCATGTTTTACTTTTAGGCGAGAACAAACATCCGGACGCAATC
ATTAACTTGAATGCAATATATGAAATGGATTATTCTATTAGAGAAGTTAA
ACTGATAAAAGATACTGACGAATTGCAACCAGTTAAAGCTGACGTGCTTA
TAGATGCCATGTTAGGCACGGGATTTTCTGGTAAAGTTAGAGAACCATTT
AGAACAGCTATTAGAGTATTTAATCAGAGCTCTGGTTTTAAGGTTTCTAT
AGATATACCCTCTGGGATAAATGCAGACGATGAAGAACAGCAGGGAGAAC
ACGTTATTCCCGACCTAATAGTCACCTTTCATGATCTTAAGCCAGGCTTA
AAAAAATTTGAGAGTAAAGTGGTCGTCAAGAAAATAGGTATTCCTAAAGA
GGCTGAAATATATGTTGGTCCCGGTGATGTCATTGTCAATGTGAAGAAAA
GAGAGTATAACACAAAGAAAGGAGATAATGGAAGAGTTTTGATCATTGGA
GGGAATTTTACATTTAGTGGAGCCCCAACTCTATCTGCTTTGGGAGCCTT
AAGGACGGGAGCAGATCTGGTATATGTCGCATCTCCAGAGGAGACAGCTA
AGGTCATCTCTAGCTTTTCCCCTGACCTTATATCTATTAAGCTTAAGGGA
AAGAATATATCTACAGACAATTTGGATGAGCTAAAACCATGGATTGATAA
AGCTGACGTCGTAGTTGTAGGACCTGGTATGGGACAAGAAAGGGAAACTG
TAGATGCTTCCATAGAGATAGTTAGATATCTGAAAGCAAAGAATAAACCT
TCAGTCATAGATGCTGATGCGTTAAAATCAGTGGCAGGTATGGAATTATT
CCCGAATGCAGTAATAACTCCTCATGCAGGAGAATTTAAGATATATTCAG
GGGTTCAGCCTGATTCGAACATGAGAAAAAGAATTGAGCAAGTGAAGGAG
TGCTCACTGAAATGTAATTGTGTAGTACTCCTTAAGGGTTATGTTGATAT
CATAGCAGAAAAGGAAGAATTTAAACTTAATAAGACAGGAAATCCTGGAA
TGGCAGTTGGCGGTACTGGGGATACATTGACAGGAATAATTGCCTCATTT
ATGGCTCAAAAACTATCTCCATTCACTTCTGCTTACTTGGGAGCATTCGT
TAATGGTTTAGCAGGGTCTATAGCATATGAAAAACTTGGCGCACATCTAG
TTGCAACAGATATAATAGAAAACATTCCTAAGGTAATTAATGAACCTTTA
GAAGTGTTCAAGAAAAAAGTGTACAAAAGGATTTTAGATACTTAGGTTTT
ACCCCTAATTCTTTTAATAATCTCAAGTGATTTGTTTGCATGTTCTTCTG
CATTTCCTAGACCGCTCAATACCTCTATAATTTTTCCGTTTTCGTCTATG
ATAAAGGTTACTCTCTGAGCACTTGAGCCTTTCTCGTTTAGAACACCGTA
TAATTTAGCTATTTGTTTATTTGAGTCAGAAACTATAGGAAATCTGGCAC
CGCATTTGTCTGCAAAACTCTTTTGAGTTGAAACTGTATCAACACTAACA
CCTATAACTTCAGCATTTAACTGTTTAAATTGGTCATAAAGTTGTCCAAA
TTTTATGGTCTCTCTAGTACAACCAGGTGTAAACGCCTTAGGATAGAAAT
ATAGTACAACTACAGATTTGCCTCTATATGAAGATAGTTTCAATTTTCCT
ATAGTTGAATCTCCTTCAAAATCAGGAGCTTCATTTCCTTTTTCTAAAGC
CATAGATTATCTGATATAAATATATTCAGTTATGGTTTTTAACCTCTTTT
TCGCTTATGCCTTACA

CHM-530: Protein Structure Report

Name_____________________________

Part 1: Translation

Paste the single letter amino acid code in the box below. (10 points)

Text Box: single letter amino acid code

Questions

1. Why are there six different frames from a single DNA sequence? (5 points)

2. Why does each red-highlighted region begin with “M”? (5 points)

Part 2

Paste the Predicted Secondary Structure in the box below. Do not paste amino acid code. (10 points)

Text Box: Predicted Secondary Structure (8 Class):

1. What do the following secondary structure designations mean? What specifically is the difference between E and B? Use “SCRATCH; A Quick Description” (http://scratch.proteomics.ics.uci.edu/explanation.html) as a reference. (7.5 points)

H: 

G: 

I: 

E: 

B: 

T: 

S:

C: 

2. From the e-mailed results from SCRATCH, what type and amount of secondary structure did the prediction tool suggest? Specifically, explain how much alpha helix and beta sheet (bridge) was found. (7.5 points)

Analyze an image that tells a story you think we need to understand

/in /by

  

Background:

In her essay “The War Photo No One Wanted to Publish,” Torie Rose DeGhett examines the history of a specific photo and the self-inflicted censorship of it by the U.S. media. DeGhett contends that the censorship of the photo bordered on deception and also supported efforts to portray Desert Storm as a ‘bloodless’ war. DeGhett says “it’s hard to calculate the consequences of a photograph’s absence. But sanitized images of warfare, the Atlantic’s Conor Friedersdorf argues, make it ‘easier . . . to accept bloodless language’ such as 1991 reference to ‘surgical strikes’ or modern-day terminology like ‘kinetic warfare’”(74). For DeGhett, the elimination of the photograph from American media affected public perception of the war, and perhaps affected public acceptance of it as well.

DeGhett’s essay focuses on a photograph taken in 1991, when large news organizations had more control over which images and stories circulated. And yet there are plenty of images and stories that largely go unseen. What images aren’t being seen today? What stories aren’t being told? Alternatively, there are images that go viral based on a cultural moment and the circulation of ideas across social media. What makes those images such powerful storytellers? What kinds of stories can images tell? 

Assignment:

· Analyze an image that tells a story you think we need to understand. This might be an image that circulated widely and you believe should not have, or that it has been misunderstood. It could be an image that you believe has not circulated enough. It could be an image that seems to perfectly and fully capture the story of a moment, and an analysis of the image’s potentials and limitations as a storyteller. The purpose of your essay is to analyze a single image and its circulation (or lack of circulation), and make an argument about the role of this image in telling the story of an event. Use DeGhett’s essay as a model for closely analyzing images, as well as for thinking about how and why images circulate and the implications of their circulation.

· You can discuss more than one visual (or written) source for evidence and context, but your essay should clearly focus on a single image and its impact.

· In place of a traditional essay, you may create a visual argument. Your visual argument should focus on a single image, even as it uses other images for context and support. A visual argument could be a photo essay, Instagram story, video. Vlog, slide presentation, or something else. DeGhett should still be used for analytical support.

· Visual arguments must be accompanied by a 1-page rhetorical explanation and reflection, in which the writer explains their choices and intentions in the visual text (why this approach, why these images, why this layout, who the intended audience is, etc.). 

Reciprocal Inhibition

/in /by

 

You can decrease the frequency of any behavior through punishment, but why not give some thought to reciprocal inhibition? Reciprocal inhibition is the process of defining the opposite of the undesirable behavior and reinforcing the positive instead. Reciprocal inhibition can be useful for leaders in helping change behaviors aiming for high reliability. For example, instead of punishing errors, reward quality.

In this Assignment you will identify where reciprocal inhibition might be used to improve patient outcomes in quality and patient safety. You will also recommend steps that will foster a culture of quality and recommend at least one strategy for overcoming the challenges of achieving a culture of high reliability.

To prepare:

Review this Week’s Learning Resources related to creating a culture of high reliability

The Assignment:

This week’s reading suggests that reciprocal inhibition is a good strategy to change reinforces in the health care system and that “culture eats strategy.”

Considering your organization, or a health care organization you are familiar with, write a 4-page paper that:

  • Describes how and where reciprocal inhibition might be used to improve patient outcomes in quality and improve patient safety.
  • Explains how using reciprocal inhibition may be an improvement in the culture of quality. Include any steps that will foster a culture of quality in an organization to become a high-reliability organization.
  • Recommend at least one strategy for overcoming the challenges of fostering a culture of high reliability.

Note: Your Assignment must be written in standard edited English. Be sure to support your work with at least five high-quality references, including two from peer-reviewed journals. Refer to the Essential Guide to APA Style for Walden Students to ensure that your in-text citations and reference list are correct. This Assignment will be graded using this rubric: Week 8 Assignment Rubric (PDF). Your Assignment should show effective application of triangulation of content and resources in your conclusion and recommendations.

https://www.beckershospitalreview.com/hospital-management-administration/5-traits-of-high-reliability-organizations-how-to-hardwire-each-in-your-organization.html

IT Project Management

/in /by

What is a project, and what are its main attributes? How is a project different from what most people do in their day-to-day jobs? Discuss the importance of top management commitment and the development of standards for successful project management. Provide examples to illustrate the importance of these items based on your experience on any type of project. Discuss the unique challenges that an IT project presents. (700 words)

And

In your peer responses (Need 2 responses – 300 words each) , be sure discuss your thoughts on project management, your views on project’s attributes, and your thoughts on successful project management. You can take opposing/differing views than your peers but be sure to provide applicable resources as needed. Properly provide examples in your peer responses as well and any additional challenges you see with IT projects. 

Please make your initial post and two response posts substantive. A substantive post will do at least two of the following:

  • Ask an interesting, thoughtful question pertaining to the topic
  • Answer a question (in detail) posted by another student or the instructor
  • Provide extensive additional information on the topic
  • Explain, define, or analyze the topic in detail
  • Share an applicable personal experience
  • Provide an outside source that applies to the topic, along with additional information about the topic or the source (please cite properly in APA). 
  • Incite text 
  • Make an argument concerning the topic.

At least one scholarly source should be used in the initial discussion thread. Use proper citations and references in your post.